![]() The result is the production of two identical double-stranded DNA molecules ( Figure 6c). At the same time, the two new sugar-phosphate backbones are formed. The base-pairing rules are the basis of this process that is, the nucleotides are added in a manner that places complementary bases opposite each other – C always opposite G and vice versa, A always opposite T and vice versa. Each of these strands now acts as a template, a mould, for DNA replication. The two complementary single strands are shown separated in Figure 6b. The two strands of the double helix shown in Figure 6a unwind, starting at one end, to expose the bases on each strand. Once the strands have been separated, new DNA strands are synthesized the enzyme that brings about this process is called DNA polymerase, which adds nucleotides to each separated strand according to the base-pairing rules.įigure 6 shows the principal stages of DNA replication. The separation of the two strands of DNA is an early event in the process of DNA replication. These interactions are known as base-pairing, for which there are very precise rules.įigure 5 Figure 5 A portion of a DNA molecule with the helix unwound, showing the complementary base pairs between the two strands held together. Along the length of a strand within the double helix, each base makes a specific pairing with a corresponding base in the other strand. The key to understanding the structure of DNA and how it functions in the cell lies in the interaction between the bases in each strand at the core of the molecule. Here each of the two ‘ribbons’ spiralled around each other represents the sugar-phosphate backbone of Figure 4, whilst the horizontal bars represent the bases of the two strands. So far we have considered a single strand of DNA, but Figure 2 showed that DNA has a double helix structure. Since there are four different bases, there are four options for each position, and therefore 4×4×4×4×4×4×4×4=65 536 possible different sequences for a DNA molecule of just eight nucleotides! A DNA molecule consisting of thousands of nucleotides therefore represents a vast store of potential information. Take, for example, a short chain of just eight nucleotides. If you look at the comparatively short sequence of 50 bases printed above, and think about how many ways a simple coding language of just four letters could be rearranged in such a sequence, you will gain some appreciation of the huge variety of sequences that is possible. If all the DNA in all your cells were stretched out end-to-end, it would reach to the Moon and back about 10 000 times! If the DNA molecules of all the chromosomes in the nucleus of a single human cell were uncoiled, stretched out straight and laid end to end, they would measure about two metres. One DNA molecule runs the full length of the chromosome. ![]() You may be surprised to learn that DNA molecules are by far the largest known molecules on Earth. …AAACGCGCGTATATAAATCGCTAGCTTCAACGACTGCTGACGTAGTTCCC…. Such a sequence might appear as follows (reading from left to right): ![]() There may be many hundreds of thousands of bases within a single strand of a DNA molecule, in a long linear sequence. This is a convention, like reading left to right and top to bottom of this page. These sequences are usually written or printed in lines like the letters or characters on this page. In this course, we will examine the chemical nature of DNA, which accounts for both its stability and the way it can be replicated – the first two of these three key properties. DNA has three key properties: it is relatively stable its structure suggests an obvious way in which the molecule can be duplicated, or replicated and it carries a store of vital information that is used in the cell to produce proteins. DNA is remarkable, breathtakingly simple in its structure yet capable of directing all the living processes in a cell, the production of new cells and the development of a fertilized egg to an individual adult.ĭNA illustrates beautifully the precise relationship between molecular structure and biological function. Genomes are composed of DNA, and a knowledge of the structure of DNA is essential to understand how it can function as hereditary material. This course explores the chemical nature of the genome. 1 Overview 1.1 DNA and the genome 1.1.1 The chemical structure of DNA ![]()
0 Comments
Leave a Reply. |